[pypy-svn] r53310 - pypy/branch/js-refactoring/pypy/lang/js/bench

santagada at codespeak.net santagada at codespeak.net
Fri Apr 4 05:18:19 CEST 2008


Author: santagada
Date: Fri Apr  4 05:18:16 2008
New Revision: 53310

Added:
   pypy/branch/js-refactoring/pypy/lang/js/bench/TODO.txt   (contents, props changed)
   pypy/branch/js-refactoring/pypy/lang/js/bench/ackermann.javascript   (contents, props changed)
   pypy/branch/js-refactoring/pypy/lang/js/bench/ary.javascript   (contents, props changed)
   pypy/branch/js-refactoring/pypy/lang/js/bench/binarytrees.javascript   (contents, props changed)
   pypy/branch/js-refactoring/pypy/lang/js/bench/fannkuch.javascript   (contents, props changed)
   pypy/branch/js-refactoring/pypy/lang/js/bench/fasta.javascript   (contents, props changed)
   pypy/branch/js-refactoring/pypy/lang/js/bench/fibo.javascript   (contents, props changed)
   pypy/branch/js-refactoring/pypy/lang/js/bench/harmonic.javascript   (contents, props changed)
   pypy/branch/js-refactoring/pypy/lang/js/bench/hash.javascript   (contents, props changed)
   pypy/branch/js-refactoring/pypy/lang/js/bench/hash2.javascript   (contents, props changed)
   pypy/branch/js-refactoring/pypy/lang/js/bench/heapsort.javascript   (contents, props changed)
Removed:
   pypy/branch/js-refactoring/pypy/lang/js/bench/f1.js
   pypy/branch/js-refactoring/pypy/lang/js/bench/f2.js
Modified:
   pypy/branch/js-refactoring/pypy/lang/js/bench/   (props changed)
Log:
first import of the benchmarks, there are still more to come

Added: pypy/branch/js-refactoring/pypy/lang/js/bench/TODO.txt
==============================================================================
--- (empty file)
+++ pypy/branch/js-refactoring/pypy/lang/js/bench/TODO.txt	Fri Apr  4 05:18:16 2008
@@ -0,0 +1,32 @@
+All benchmarks are from The Computer Language Benchmarks Game, licensed under the revised BSD License
+
+Parameters for the benchmarks:
+
+ackermann 9,10,11
+ary 3000,5000,7000,9000
+binarytrees 12,14,16
+fannkuch 9,10,11
+fasta (substring) 250000,2500000,25000000
+fibo 12,24,32
+harmonic 6000000,8000000,10000000
+hash 40000,60000,80000,100000
+hash2 50,100,150,200
+heapsort 20000,40000,60000,80000,100000
+hello ?
+knucleotide (without one simple regex)
+lists (concat) @0
+matrix @0
+methcall @0
+nbody
+nestedloop @0
+nsieve
+nsievebits
+objinst @0
+partialsums (sin, cos, pow)
+random @0
+recursive
+sieve @0
+spectralnorm (sqrt)
+strcat @0
+sumcol (readline!)
+takfp @0

Added: pypy/branch/js-refactoring/pypy/lang/js/bench/ackermann.javascript
==============================================================================
--- (empty file)
+++ pypy/branch/js-refactoring/pypy/lang/js/bench/ackermann.javascript	Fri Apr  4 05:18:16 2008
@@ -0,0 +1,15 @@
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// contributed by Sjoerd Visscher
+
+function ack(m, n) {
+  return (m == 0
+    ? n + 1
+    : (n == 0
+      ? ack(m - 1, 1) 
+      : ack(m - 1, ack(m, n - 1))));
+}
+
+var n = arguments[0];
+print("ack(3, " + n + "): " + ack(3, n));

Added: pypy/branch/js-refactoring/pypy/lang/js/bench/ary.javascript
==============================================================================
--- (empty file)
+++ pypy/branch/js-refactoring/pypy/lang/js/bench/ary.javascript	Fri Apr  4 05:18:16 2008
@@ -0,0 +1,23 @@
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// contributed by David Hedbor
+// modified by Isaac Gouy
+
+var i, k;
+
+var n = arguments[0];
+var x = Array(n);
+var y = Array(n);
+
+for (i = 0; i < n; i++) {
+  x[i] = i + 1;
+  y[i] = 0; // Need to set all entries in i to zero or the result will be NaN 
+}
+for (k = 0 ; k < 1000; k++) {
+  for (i = n-1; i >= 0; i--) {
+    y[i] += x[i];
+  }
+}
+print(y[0], y[n-1]);
+

Added: pypy/branch/js-refactoring/pypy/lang/js/bench/binarytrees.javascript
==============================================================================
--- (empty file)
+++ pypy/branch/js-refactoring/pypy/lang/js/bench/binarytrees.javascript	Fri Apr  4 05:18:16 2008
@@ -0,0 +1,51 @@
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+function TreeNode(left,right,item){
+   this.left = left;
+   this.right = right;
+   this.item = item;
+}
+
+TreeNode.prototype.itemCheck = function(){
+   if (this.left==null) return this.item;
+   else return this.item + this.left.itemCheck() - this.right.itemCheck();
+}
+
+function bottomUpTree(item,depth){
+   if (depth>0){
+      return new TreeNode(
+          bottomUpTree(2*item-1, depth-1)
+         ,bottomUpTree(2*item, depth-1)
+         ,item
+      );
+   }
+   else {
+      return new TreeNode(null,null,item);
+   }
+}
+
+
+var minDepth = 4;
+var n = arguments[0];
+var maxDepth = Math.max(minDepth + 2, n);
+var stretchDepth = maxDepth + 1;
+
+var check = bottomUpTree(0,stretchDepth).itemCheck();
+print("stretch tree of depth " + stretchDepth + "\t check: " + check);
+
+var longLivedTree = bottomUpTree(0,maxDepth);
+for (var depth=minDepth; depth<=maxDepth; depth+=2){
+   var iterations = 1 << (maxDepth - depth + minDepth);
+
+   check = 0;
+   for (var i=1; i<=iterations; i++){
+      check += bottomUpTree(i,depth).itemCheck();
+      check += bottomUpTree(-i,depth).itemCheck();
+   }
+   print(iterations*2 + "\t trees of depth " + depth + "\t check: " + check);
+}
+
+print("long lived tree of depth " + maxDepth + "\t check: " 
+   + longLivedTree.itemCheck());

Added: pypy/branch/js-refactoring/pypy/lang/js/bench/fannkuch.javascript
==============================================================================
--- (empty file)
+++ pypy/branch/js-refactoring/pypy/lang/js/bench/fannkuch.javascript	Fri Apr  4 05:18:16 2008
@@ -0,0 +1,66 @@
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+function fannkuch(n) {
+   var check = 0;
+   var perm = Array(n);
+   var perm1 = Array(n);
+   var count = Array(n);
+   var maxPerm = Array(n);
+   var maxFlipsCount = 0;
+   var m = n - 1;
+
+   for (var i = 0; i < n; i++) perm1[i] = i;
+   var r = n;
+
+   while (true) {
+      // write-out the first 30 permutations
+      if (check < 30){
+         var s = "";
+         for(var i=0; i<n; i++) s += (perm1[i]+1).toString();
+         print(s);
+         check++;
+      }
+
+      while (r != 1) { count[r - 1] = r; r--; }
+      if (!(perm1[0] == 0 || perm1[m] == m)) {
+         for (var i = 0; i < n; i++) perm[i] = perm1[i];
+
+         var flipsCount = 0;
+         var k;
+
+         while (!((k = perm[0]) == 0)) {
+            var k2 = (k + 1) >> 1;
+            for (var i = 0; i < k2; i++) {
+               var temp = perm[i]; perm[i] = perm[k - i]; perm[k - i] = temp;
+            }
+            flipsCount++;
+         }
+
+         if (flipsCount > maxFlipsCount) {
+            maxFlipsCount = flipsCount;
+            for (var i = 0; i < n; i++) maxPerm[i] = perm1[i];
+         }
+      }
+
+      while (true) {
+         if (r == n) return maxFlipsCount;
+         var perm0 = perm1[0];
+         var i = 0;
+         while (i < r) {
+            var j = i + 1;
+            perm1[i] = perm1[j];
+            i = j;
+         }
+         perm1[r] = perm0;
+
+         count[r] = count[r] - 1;
+         if (count[r] > 0) break;
+         r++;
+      }
+   }
+}
+
+var n = arguments[0];
+print("Pfannkuchen(" + n + ") = " + fannkuch(n));

Added: pypy/branch/js-refactoring/pypy/lang/js/bench/fasta.javascript
==============================================================================
--- (empty file)
+++ pypy/branch/js-refactoring/pypy/lang/js/bench/fasta.javascript	Fri Apr  4 05:18:16 2008
@@ -0,0 +1,88 @@
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      print( seq.substring(seqi, seqi+lenOut) );
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      print( s + seq.substring(0, seqi) );
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    print( line.join('') );
+    n -= line.length;
+  }
+}
+
+var n = arguments[0]
+
+print(">ONE Homo sapiens alu")
+fastaRepeat(2*n, ALU)
+
+print(">TWO IUB ambiguity codes")
+fastaRandom(3*n, IUB)
+
+print(">THREE Homo sapiens frequency")
+fastaRandom(5*n, HomoSap)

Added: pypy/branch/js-refactoring/pypy/lang/js/bench/fibo.javascript
==============================================================================
--- (empty file)
+++ pypy/branch/js-refactoring/pypy/lang/js/bench/fibo.javascript	Fri Apr  4 05:18:16 2008
@@ -0,0 +1,14 @@
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// contributed by David Hedbor
+// modified by Isaac Gouy
+
+function fib(n) {
+    if (n < 2) return 1;
+    return fib(n-2) + fib(n-1);
+}
+
+var n = arguments[0];
+print(fib(n));
+

Added: pypy/branch/js-refactoring/pypy/lang/js/bench/harmonic.javascript
==============================================================================
--- (empty file)
+++ pypy/branch/js-refactoring/pypy/lang/js/bench/harmonic.javascript	Fri Apr  4 05:18:16 2008
@@ -0,0 +1,9 @@
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// contributed by Isaac Gouy 
+
+var n = arguments[0], partialSum = 0.0;
+for (var d = 1; d <= n; d++) partialSum += 1.0/d;
+print(partialSum.toFixed(9));
+

Added: pypy/branch/js-refactoring/pypy/lang/js/bench/hash.javascript
==============================================================================
--- (empty file)
+++ pypy/branch/js-refactoring/pypy/lang/js/bench/hash.javascript	Fri Apr  4 05:18:16 2008
@@ -0,0 +1,18 @@
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// contributed by David Hedbor
+// modified by Isaac Gouy
+
+var i, c = 0;
+var n = arguments[0];
+
+var X = new Object();
+for (i=1; i<=n; i++) {
+   X[i.toString(16)] = i;
+}
+for (i=n; i>0; i--) {
+  if (X[i.toString()]) c++;
+}
+print(c);
+

Added: pypy/branch/js-refactoring/pypy/lang/js/bench/hash2.javascript
==============================================================================
--- (empty file)
+++ pypy/branch/js-refactoring/pypy/lang/js/bench/hash2.javascript	Fri Apr  4 05:18:16 2008
@@ -0,0 +1,28 @@
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// contributed by David Hedbor
+// modified by Isaac Gouy
+
+var n = arguments[0];
+var hash1 = Object();
+var hash2 = Object();
+var arr = Array(10000);
+var idx;
+
+for (i=0; i<10000; i++) {
+  idx = "foo_"+i;
+  hash1[idx] = i;
+  // Do this here and run loop below one less since += on an undefined
+  // entry == NaN.
+  hash2[idx] = hash1[idx];
+}
+
+for (i = 1; i < n; i++) {
+  for(a in hash1) {
+    hash2[a] += hash1[a];
+  }
+}
+
+print(hash1["foo_1"], hash1["foo_9999"],
+      hash2["foo_1"], hash2["foo_9999"]);

Added: pypy/branch/js-refactoring/pypy/lang/js/bench/heapsort.javascript
==============================================================================
--- (empty file)
+++ pypy/branch/js-refactoring/pypy/lang/js/bench/heapsort.javascript	Fri Apr  4 05:18:16 2008
@@ -0,0 +1,57 @@
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// contributed by David Hedbor
+// modified by Isaac Gouy
+
+var IM = 139968;
+var IA = 3877;
+var IC = 29573;
+
+var last = 42;
+
+function gen_random(max) { return(max * (last = (last * IA + IC) % IM) / IM); }
+
+function heapsort(n, ra) {
+    var l, j, ir, i;
+    var rra;
+
+    l = (n >> 1) + 1;
+    ir = n;
+    for (;;) {
+        if (l > 1) {
+            rra = ra[--l];
+        } else {
+            rra = ra[ir];
+            ra[ir] = ra[1];
+            if (--ir == 1) {
+                ra[1] = rra;
+                return;
+            }
+        }
+        i = l;
+        j = l << 1;
+        while (j <= ir) {
+            if (j < ir && ra[j] < ra[j+1]) { ++j; }
+            if (rra < ra[j]) {
+                ra[i] = ra[j];
+                j += (i = j);
+            } else {
+                j = ir + 1;
+            }
+        }
+        ra[i] = rra;
+    }
+}
+
+
+var n = arguments[0];
+var ary, i;
+    
+// create an array of N random floats
+ary = Array(n+1);
+for (i=1; i<=n; i++) {
+  ary[i] = gen_random(1.0);
+}
+heapsort(n, ary);
+print(ary[n].toFixed(10));


More information about the pypy-svn mailing list